Skip to content


  • Research article
  • Open Access

The organization and evolution of the Responder satellite in species of the Drosophila melanogaster group: dynamic evolution of a target of meiotic drive

BMC Evolutionary Biology201414:233

Received: 21 October 2014

Accepted: 5 November 2014

Published: 25 November 2014



Satellite DNA can make up a substantial fraction of eukaryotic genomes and has roles in genome structure and chromosome segregation. The rapid evolution of satellite DNA can contribute to genomic instability and genetic incompatibilities between species. Despite its ubiquity and its contribution to genome evolution, we currently know little about the dynamics of satellite DNA evolution. The Responder (Rsp) satellite DNA family is found in the pericentric heterochromatin of chromosome 2 of Drosophila melanogaster. Rsp is well-known for being the target of Segregation Distorter (SD) an autosomal meiotic drive system in D. melanogaster. I present an evolutionary genetic analysis of the Rsp family of repeats in D. melanogaster and its closely-related species in the melanogaster group (D. simulans, D. sechellia, D. mauritiana, D. erecta, and D. yakuba) using a combination of available BAC sequences, whole genome shotgun Sanger reads, Illumina short read deep sequencing, and fluorescence in situ hybridization.


I show that Rsp repeats have euchromatic locations throughout the D. melanogaster genome, that Rsp arrays show evidence for concerted evolution, and that Rsp repeats exist outside of D. melanogaster, in the melanogaster group. The repeats in these species are considerably diverged at the sequence level compared to D. melanogaster, and have a strikingly different genomic distribution, even between closely-related sister taxa.


The genomic organization of the Rsp repeat in the D. melanogaster genome is complex it exists of large blocks of tandem repeats in the heterochromatin and small blocks of tandem repeats in the euchromatin. My discovery of heterochromatic Rsp-like sequences outside of D. melanogaster suggests that SD evolved after its target satellite and that the evolution of the Rsp satellite family is highly dynamic over a short evolutionary time scale (<240,000 years).


  • Satellite DNA
  • Segregation Distorter
  • Responder
  • Drosophila
  • Meiotic drive
  • Concerted evolution


Genomes are frequently in conflict with selfish genetic elements that propagate in genomes or populations despite the harm that they cause to the host [1]-[3]. Genetic elements can range in their degree of selfishness from the expansion of blocks of tandemly repeated satellite DNAs [4] typically found near centromeres and telomeres [5], to the invasive properties of transposable elements or the ultra-selfish behavior of meiotic drivers. Meiotic drivers spread in populations by gaining a transmission advantage through gametogenesis [6]. Segregation Distorter (SD) is an autosomal male meiotic drive system in Drosophila melanogaster that has biased transmission while heterozygous females transmit SD fairly to half of their progeny, heterozygous males transmit SD to nearly all of their progeny [7]. SD targets Responder (Rsp), a satellite DNA in the pericentric heterochromatin of 2R [8],[9]. The sensitivity of the Rsp locus to segregation distortion correlates positively with the number of repeats on 2R SD targets wild-type chromosomes with many Rsp repeats [8],[9] resulting in wild-type sperm dysfunction through a currently unknown mechanism (reviewed in [10]).

The structure of the Rsp locus is complex: the canonical form of the repeat is a dimer of two related 120-bp repeats referred to as Left and Right Rsp (84% identical), but the tandemly arrayed canonical repeats are interspersed with more divergent variants of Rsp [11]. At least two additional locations of Rsp repeats exist outside of the SD target in 2R pericentric heterochromatin: a cluster of repeats occurs on 3L in cytological band 80C [12], and a single fragment of a Rsp repeat occurs on 2R at cytological band 60A [11].

The evolutionary dynamics of the Rsp satellite are currently unknown. SD is a selfish genetic system specific to D. melanogaster. While the divergence between the Right and Left Rsp repeats suggests that the repeat is old, it has never been found outside of D. melanogasterimplying that the repeat arose in an ancestor of the melanogaster group and was subsequently lost outside of D. melanogaster, or it is rapidly evolving in D. melanogaster. These inferences resulted from studies based on DNA-DNA hybridization or poorly assembled and fairly low coverage genomes, however, and currently available genomic resources could provide new insights into the evolutionary history of Rsp repeat family evolution.

We know little about the evolutionary dynamics of satellite DNAs in general. Many repetitive DNAs undergo concerted evolution [13]-[15], whereby unequal recombination and/or gene conversion events cause repeats within a species to be more similar to each other than to their homologous repeats between species [15]-[20]. While concerted evolution is documented among various repetitive DNA sequences, the effect of intragenomic conflict on any particular family of repeats is understudied. While some satellite DNAs are expected to be selfish themselves, the Rsp repeats of D. melanogaster are instead (or perhaps in addition), the target of a selfish meiotic driver, making these especially interesting repeats to study. An evolutionary genetic analysis of the Rsp family of repeats could reveal important details about the evolutionary history of SD, as well as the dynamics of satellite DNAs and the effect of intragenomic conflict on genome evolution.

In this paper, I present an evolutionary genomic analysis of the Rsp satellite in D. melanogaster and the three closely related species of the simulans clade (D. simulans, D. sechellia and D. mauritiana). I combine traditional Sanger sequencing data (from BACs and Whole Genome Shotgun assemblies), Next Generation Sequencing (NGS) data (from genomic Illumina reads), and in situ hybridization to study patterns of Rsp satellite evolution on a short evolutionary time scale. I show that Rsp repeats have euchromatic locations throughout the D. melanogaster genome, that Rsp arrays show evidence for concerted evolution, and that Rsp repeats exist outside of D. melanogaster, in species of the melanogaster group. My analyses suggest that Rsp repeat family evolution is highly dynamic, and are consistent with the rapid evolution of Rsp in D. melanogaster, where it is a target of meiotic drive.

Results and discussion

Rsp in D. melanogaster

I used BLAST to identify Rsp repeats in the WGS assembly of D. melanogaster and found hits on nearly every chromosome arm (Figure 1). As expected, large blocks of canonical Rsp repeats defined as the sequences similar to those correlated with the sensitivity to segregation distortion in Wu et al. [9] occur on chromosome 2R (these repeats in versions of the D. melanogaster genome prior to v6.01 were found in ArmU and ArmU extra scaffolds). These repeats correspond to the large block of satellite in the pericentric heterochromatin on chromosome 2R. Consistent with previous findings [12], at least one large block of canonical Rsp repeats occurs on chromosome 3L. However, I found several small blocks of Rsp-like repeats in the euchromatic regions of X, 2R, 3L and 3R (Figure 1B and C). Interestingly, the largest block of euchromatic repeats is found on chromosome 3L, in an intron of the gene Argonaute 3 (Ago3). The Ago3 repeats are canonical Rsp repeats (Figure 1B). The euchromatic Rsp repeats consist of between 1 and 12 repeats which, because the assembly of repetitive sequences tends to collapse repeats with nearly-identical sequences, may be considered estimates of the minimum repeat number. The second largest euchromatic Rsp blocks occur on the X chromosome. The Rsp-like repeats found on the X chromosome are not canonical Rsp repeats, but divergent copies of a Rsp family repeat (hereon referred to as RlX for Rsp-like on X; P-value from permuted alignments with D. melanogaster canonical Rsp <10−4; Figure 1B). There are three clusters of interspersed RlX repeats in cytological band 4C on the X chromosome (occurring within a 150 kb interval). The three clusters span 715 bp, 120 bp and 1430 bp, respectively, with the largest cluster occurring within 1 kb of the gene CG12688. I compared all individual WGS reads matching canonical Rsp to estimate genome-wide variability in Rsp repeat sequence. Overall, individual reads matching the Left and Right canonical Rsp sequences from across the genome shared 85.8% and 87.6% identity, indicating that there is considerable variability in canonical Rsp repeats in the genome.
Figure 1
Figure 1

Rsp organization in the D. melanogaster genome. A.) Organization of canonical Rsp repeats as a dimer of Right and Left repeats. B.) Pie charts showing the relative abundances of Right, Left Rsp and their variants, and RlX repeats, across the D. melanogaster genome. h39 is a BAC that maps to the heterochromatic cytological band h39 the target of SD. 80C Rsp corresponds to repeats mapping to cytological band 80C on chromosome 3L. C.) Rsp repeat counts across the euchromatic D. melanogaster genome. Plotted are Rsp repeat counts along each chromosome arm in Mb of the euchromatic genome assembly. Shaded in grey are pericentric heterochromatin regions and black circles correspond to centromeres. A schematic of an assembly of unmapped BACs appears above the chromosome plots showing that blocks of Rsp repeats (in black) occur in clusters and are interspersed in the heterochromatin.

Because during genome assembly, reads from identical or nearly identical sequences may be collapsed into a single sequence or mapped to the wrong location, repetitive regions of the genome are often misassembled [21]. This makes it difficult to reliably compare repeats in different regions of the WGS assembly. To compare repeats between regions of the genome, I instead used BLAST to identify Rsp repeats in sequenced BACs mapping to known genomic locations. I obtained hits on BACs that map to euchromatic and heterochromatic locations in the genome, including the 2R heterochromatic division called h39, the target of SD [8]. The BAC categorized as h39 (AC246306.1) contains clusters of Bari-1 repeats that define the distal boundary of the Rsp locus at h39 [22], (Additional file 1: Table S1). Within arrays (defined here as tandem blocks of Rsp repeats on non-overlapping BACs), I categorized repeats into the canonical Left repeats, canonical Right repeats, and variants of the canonical Rsp repeats. Among BACs that are unmapped and likely correspond to pericentric heterochromatin, there is less variability within Left (89.5 percent identity, 95% C.I. 79.5-100: Table 1) and Right (90.4 percent identity, 95% C.I. 82.3-100; Table 1) than between Left and Right repeats (82.4 percent identity, 95% C.I. 76.0-89.8; Table 1). The repeats that map to h39 (the target of SD), appear more similar (i.e. fewer differences among repeats within the array) than the unmapped reads (Table 1). The repeats in the 3L cluster are the most similar of the main blocks of Rsp repeats (Table 1). The RlX repeats are 52.5-57.7 percent identical (%ID) to the consensus canonical Rsp sequences over their entire length but well conserved over bases 57 110 in the consensus canonical Rsp sequences (RlX vs. Left Rsp is 76.7-79.1%ID; RlX vs. Right Rsp is 79.1-86%ID). Moschetti et al. [12] posited that the original canonical Rsp repeats were identified from a clone that actually maps to 3L instead of h39. Consistent with this idea, Rsp repeats found at 80C on chromosome 3L are primarily the canonical Rsp sequences, whereas repeats found at h39, and unmapped BACs are a mix of canonical Rsp and their variants, where variants are defined as repeats that fall between 79.5%-90% identical to right or left canonical Rsp repeats (Figure 1B).
Table 1

Percent identity within and between canonical Rsp repeat types, for BACs from unmapped regions, h39 (target of SD ) , and 3L

BAC location

Within-repeat type %ID

Between-repeat type %ID





89.5 (79.5-100)

90.4 (82.3-100)

82.4 (76.0-89.8)


99.6 (99.1-100)

92.1 (84.1-100)

81.5 (80.6-82.3)


96.5 (93.0-100)

90.1 (94.5-100)

79.4 (76.2-91.9)

Canonical repeats have the little variation on 3L and at h39, but are highly variable on the unmapped BAC. Variability between Left and Right canonical repeats does not differ between regions.

A neighbor-joining tree constructed from Rsp repeats found in clusters on different BACs confirms that repeats within an array tend to be more similar to each other than repeats outside of an array (Figure 2), a pattern consistent with a history of concerted evolution. Surprisingly, for some repeat clusters, it appears that there is even exchange between arrays of repeats in different genomic locations and perhaps even different chromosome arms (between unmapped BACs whose likely location is chromosome 2R and 3L BACs; Figure 2). It is however possible that the unmapped BACs map to pericentric heterochromatin on 3L instead of 2R, however if this were the case, this result still demonstrates exchange between distinct clusters of repeats (no portion of Ago3 occurs on this unmapped BAC). Unfortunately, I was unable to conclusively determine the genomic location of the unmapped BACs [23], (Additional file 1: Figure S1). The Rsp repeats found on BACs mapping to 2R (at h39) and 3L are very similar [23] (Additional file 1: Table S2), consistent with previous observations [24]. While this may be evidence for rare interchromosomal exchange between 2R and 3L, such exchange has not been documented for other repeat families in Drosophila. Alternatively, selective sweeps involving the 2R pericentric heterochromatin could also cause repeats on different chromosomes to be more closely related to each other than nearby repeats, as the different chromosomes would have the same recent common ancestor [24].
Figure 2
Figure 2

D. melanogaster Rsp repeat clusters across the genome. Plotted is a neighbor-joining tree of Rsp repeats on BACs across the genome. BACs are color-coded according to location.

Rsp family repeats in simulans clade species

Although the Rsp satellite has not been described outside of D. melanogaster [9],[24],[25], I found repeats similar to Rsp in each species of the simulans clade, and in D. erecta and D. yakuba (hereon referred to as Rsp-like; [23], Additional file 1: Table S3). I used BLAST to identify sequences related to the D. melanogaster Rsp repeat in the WGS assemblies of D. sechellia, D. simulans, D. erecta and D. yakuba (P-values from permuted alignments with D. melanogaster canonical Rsp are <10−4 for each species). The repeat unit of Rsp-like is larger than canonical Rsp: Rsp-like is ~160 bp in the simulans clade and 173 bp in D. erecta, whereas canonical Rsp in D. melanogaster is ~120 bp. Throughout the paper, only the ~120 bp homologous to canonical Rsp is analyzed. Interestingly, D. erecta Rsp-like repeats appear to have a dimeric structure analogous to the Left and Right repeats of D. melanogaster. I refer to the D. erecta repeats as Rsp-like-1 and Rsp-like-2 (there is 9.5% divergence between the pairs) to avoid confusion with the Left and Right repeats of D. melanogaster because the dimeric structures appear independently derived.

Because repetitive sequences are often underrepresented and misassembled in traditional WGS assemblies [21],[26],[27], I also queried the reads of Illumina NGS datasets in D. melanogaster and species of the simulans clade D. simulans, D. sechellia and D. mauritianafor Rsp sequences. Using the consensus of Rsp-like sequences as references, I identified Rsp and Rsp-like repeats among the NGS reads of D. melanogaster, D. sechellia, D. simulans, and D. mauritiana using Bowtie2 (KP016744-KP016746). I collected all unique Rsp sequences (individual repeat units) by constructing de novo assemblies of all canonical Rsp and Rsp-like reads for each species (see Methods; Table 2). Species vary widely in their number of unique repeats: D. sechellia, in particular, has an order of magnitude more unique repeats than the other species (Table 2).
Table 2

Number of unique Rsp or Rsp-like repeats in D. melanogaster or the simulans clade, respectively


Unique repeats a

D. melanogaster


D. simulans


D. sechellia


D. mauritiana


aThe number of unique Rsp or Rsp-like repeats extracted from the de novo assemblies of NGS reads (see Methods).

Because several indels differentiate repeats within and between species, I constructed a neighbor joining tree based on distance using a model that considers adjacent indels as a 5th nucleotide state. This tree was constructed for unique Rsp and Rsp-like sequences (excluding RlX repeats and partial repeat units) in D. melanogaster and species of the simulans clade with D. yakuba as the outgroup [23]. The tree topology reveals that Rsp-like sequences in D. simulans, D. sechellia and D. mauritiana are very similar (Figure 3). The divergence between the canonical D. melanogaster Left and Right Rsp (79-82% ID) implies that the repeat family originated before the speciation of melanogaster group species, assuming a molecular clock. However, the Rsp repeats in D. melanogaster form a monophyletic group, whereas the Rsp-like repeats of the simulans clade species are intercalated throughout the tree (Figure 3). I also inferred the best maximum likelihood tree for all unique Rsp and Rsp-like sequences and found the same pattern [23], (Additional file 1: Figure S2). The canonical D. melanogaster Rsp and simulans clade species Rsp-like repeats are highly similar in the first 28 bp and the last 66 bp, but difficult to align in the middle. I am therefore uncertain of the length of the internal branch leading to the D. melanogaster repeats (Figure 3). Taken together, the excess divergence and monophyly of Rsp repeats on the D. melanogaster branch implies that there has been accelerated evolution in this lineage, where it is the target of SD.
Figure 3
Figure 3

Neighbor joining tree of unique Rsp sequences in D. melanogaster and Rsp-like sequences in species of the simulans clade with D. yakuba as the outgroup suggests that Rsp evolves rapidly in D. melanogaster . These unique sequences were compiled from the NGS reads in each species. The Rsp-like sequences of D.simulans (red), D. sechellia (blue) and D. mauritiana (orange) are interleaved throughout the tree whereas the canonical Rsp in D. melanogaster (green) forms its own clade.

Relationship between heterochromatic and euchromatic repeats

In addition to the heterochromatic Rsp-like repeats, the WGS assemblies of D. sechellia and D. simulans include the euchromatic RlX repeats. To examine the relationship between the heterochromatic Rsp and Rsp-like repeats and the euchromatic RlX in D. melanogaster, D. simulans, D. sechellia, D. mauritiana, D. erecta and D. yakuba, I constructed phylogenies using MrBayes. To test for concerted evolution of the euchromatic RlX repeats, I selected three RlX repeats occurring in orthologous positions upstream of the X-linked gene CG12688 for D. melanogaster, D. sechellia and D. simulans. The tree suggests that the D melanogaster canonical Rsp repeats are indeed monophyletic and evolving rapidly. The tree topology indicates that the Rsp-like repeats of the simulans clade groups with canonical Rsp repeats of D. melanogaster, but with low posterior probability (60%; Figure 4). Comparing overall percent identity, the RlX repeats are more similar to the Rsp-like repeats of the simulans clade than canonical D. melanogaster Rsp repeats: whereas RlX to Rsp-like percent identify varies between 75.6-80.7%, RlX to Rsp (canonical) only varies from 55.6-61.5% [23], again suggesting that canonical Rsp repeats evolve rapidly in D. melanogaster. Although it is possible that canonical Rsp is an old repeat that was lost in the simulans clade, the tree topology suggests that this is not the case (Figure 4). The polytomy between the simulans clade RlX repeats, the D. melanogaster RlX repeats and the heterochromatic Rsp and Rsp-like repeats of D. melanogaster and the simulans clade (Figure 4) may be influenced by gene conversion events between RlX repeats and canonical Rsp repeats in D. melanogaster [23]. A comparison of the three tandem RlX repeats in orthologous positions on the X chromosome (in cytological band 4C upstream of CG12688) revealed a pattern of concerted evolution: repeats within a species are more similar than repeats at the orthologous positions between species (Figure 4).
Figure 4
Figure 4

Rsp family satellite evolution. Bayesian tree showing the relationship between three orthologous euchromatic RlX repeats in D. melanogaster, D. sechellia and D. simulans, and the heterochromatic Rsp-like sequences of the simulans clade species, D. erecta, and D. yakuba, and the canonical (Left and Right) Rsp repeats of D. melanogaster. The Rsp-like repeats of the simulans clade species represent the consensus of all unique Rsp-like repeats assembled from the NGS reads (see Methods) and the Rsp-like repeats of D. erecta and D. yakuba represents the consensus of all Rsp-like repeats in the WGS assembly. D. erecta has two related Rsp-like repeats: Rsp-like-1 and Rsp-like-2. Posterior probability as a percent is indicated at the nodes, with values <80% shaded in grey. The tree was rooted post-hoc at the ancestor of D. yakuba and D. erecta.

Dynamic genomic distribution of Rsp-like repeats

The WGS assembly and NGS reads cannot give a complete picture of the satellite DNA distribution in these genomes because of assembly difficulties in heterochromatin. To determine the large-scale organization of the Rsp repeats in these species, I used FISH on mitotic chromosomes from larval neuroblasts using probes specific to D. melanogaster Rsp (for D. melanogaster FISH) or D. sechellia Rsp (for D. sechellia, D. simulans and D. mauritiana FISH). Small euchromatic satellite repeat islands are not detectable at this resolution, instead the FISH reveals the locations of large blocks of tandem satellite repeats. I discovered that the amount and distribution of Rsp-like repeats varies between the species. Rsp-like repeats exist as large blocks of satellite DNA in D. sechellia and D. simulans but not D. mauritiana (they are not detectable using FISH on mitotic figures; these repeats are also not detectable in D. yakuba, data not shown). The D. melanogaster probe does not cross hybridize with simulans clade species and the D. sechellia probe does not cross hybridize with D. melanogaster. Furthermore, the genomic location of Rsp-like satellite blocks has changed dramatically between species. Whereas in D. melanogaster, the Rsp satellite is located in the pericentric region of 2R, in D. sechellia the Rsp-like satellite is in the pericentric region of 2R, 3R and 3L, and in D. simulans, the Rsp-like satellite occurs only at the base of the X chromosome (Figure 5). The chromosome arms of these species are homologous and have extremely high degrees of synteny [28] they appear to mostly differ at a gross scale in their distribution of satellite repeats.
Figure 5
Figure 5

FISH showing Rsp satellite blocks in D. melanogaster and species of the simulans clade. Rsp and Rsp-like repeats are evolutionarily dynamic at the chromosome level.


We currently know little about the evolution of satDNA, despite that it can make up a significant fraction of eukaryotic genomes [29]: >50% of the genome in kangaroo rats [30] and tenebrionid beetles [31]. Because of its ability to spread in genomes without offering any benefit to the host, satDNA has been considered selfish, junk DNA [1]-[3]. However, subsequent work in evolutionary, molecular, cellular, and cancer biology has converged on the idea that the heterochromatic fraction of the genome, including satDNAs, has important functional consequences [32]-[46]. While some blocks of satellite DNA themselves may exhibit meiotic drive, or biased transmission through gametogenesis [6] in females [47],[48], the topic of this study the Responder (Rsp) satellite is a instead the target of meiotic drive in male D. melanogaster [7]. My discovery of highly dynamic evolution in the Rsp satellite family offers a model system to study the evolutionary dynamics of satDNA and the genetic conflict surrounding this enigmatic compartment of the genome.

Most of what we know about satellite DNA dynamics is at the resolution of large blocks of satellite DNA on chromosome arms. Assembly issues with repetitive DNA have stymied our understanding of satellite DNA evolutionary dynamics at the genomic level [21]. Using information from the physical map (e.g. BACs [27],[49]) and deep Illumina sequencing in combination with FISH offers a higher resolution image of satellite DNA evolution within and between species. My analysis of the Rsp satellite DNA family demonstrates that Rsp: 1) exists outside of the large block of pericentromeric satellite in locations across the D. melanogaster genome; 2) exists in species of the melanogaster group; 3) shows evidence for concerted evolution; and 4) is evolutionary dynamic in its abundance and genomic distribution over short evolutionary time scales.

Euchromatic satellite repeat islands

The Rsp satellite is a particularly interesting satellite DNA because it is the target of the SD meiotic drive system in D. melanogaster. Moschetti et al. [12] showed using FISH on polytene chromosomes that a small block of Rsp exists on chromosome 3L, outside the region associated with SD (at heterochromatic division h39 on 2R). I show here that in addition to the block of repeats on 3L, Rsp family repeats exist in euchromatic satellite repeat islands in locations across the D. melanogaster genome, most notably on 3L and the X chromosome (RlX repeats). Variable tandem repeats in several taxa have been considered as possible sources of gene regulatory variation (reviewed in [50]). It is possible that these Rsp repeat islands have some regulatory role in the expression of nearby genes or local chromatin condensation: in some cases they occur in or near genes in D. melanogaster. Similar to the genomic distribution of Rsp, short, euchromatic blocks of up to 5 tandem repeats were recently reported clustering in or near genes for satellites of the 1.688 family [14] in D. melanogaster.

The largest euchromatic Rsp islands are on 3L and the X chromosome. The X chromosome has a special role in the SD system: escapers from SD-mediated meiotic drive have biased sex ratio [51], and X-linked suppressors of SD segregate at high frequencies in natural populations [52],[53]. Some X chromosomes therefore seem to offer a protective effect against SD. Factors that suppress SD map to at least three regions of the X chromosome [54], and some of these intervals contain RlX repeats. It will be interesting to determine if the RlX repeats are involved in suppression of the SD system. One recently proposed hypothesis for the molecular mechanism of segregation distortion suggests that repeat-associated small interfering RNAs (rasiRNAs) corresponding to Rsp are necessary for proper packaging of the satellite during spermiogenesis, and that SD interferes with the production or localization of these rasiRNAs [10],[55],[56]. Many satellite DNAs in D. melanogaster [37] and other taxa [34],[57],[58] are transcribed and processed into small RNAs, including Rsp ([59]; Larracuente, unpublished). One possibility is that these euchromatic Rsp satellite repeat islands correspond to Rsp rasiRNA-producing clusters.

Dynamic satellite DNA evolution on small time scales

SD is a melanogaster-specific drive system [60],[61], but the history of the Rsp satellite has been unclear. While divergence between the Left and Right canonical Rsp repeats suggests that the repeat is old, the repeats had not been reported outside of D. melanogaster previously [9], although some studies indicated that divergent copies of the repeat may exist in D. simulans [24],[25]. My results demonstrate conclusively that Rsp-like sequences exist in abundance in the closely-related species of the simulans clade, adding important insight into the evolution of the SD system SD arose in D. melanogaster in a background that already had Rsp repeats to target. The D. melanogaster canonical Rsp is highly divergent compared to the Rsp-like repeats of the simulans clade species (e.g. 56-63% ID) and monophyletic, suggesting that Rsp has accelerated evolution in D. melanogaster. What might drive the rapid evolution of this repeat family in D. melanogaster? One possibility is that the mutation rate is unusually high for D. melanogaster Rsp compared to the Rsp-like repeats in the simulans clade species. An alternative explanation is that in D. melanogaster, segregation distortion against the canonical Rsp repeats by SD creates selection pressure to diverge from the target sequence. At present, we do not know the molecular mechanism of distortion, or what feature of the Rsp locus makes it a target (i.e. if it is sequence-specific). Efforts to compare the detailed evolutionary history of Rsp family repeats in the melanogaster group are underway.

Comparing Rsp repeat sequences within and between species revealed that Rsp and Rsp-like sequences show at least two lines of evidence for concerted evolution: 1) repeats within the D. melanogaster genome are more similar within a genomic cluster than between genomic clusters; and 2) RlX repeats between D. melanogaster and species of the simulans clade are most closely related to nearby repeats within each species than to repeats at orthologous positions between species.

At least in part due to the mutational properties of repetitive DNA [62], the turnover in satellite DNAs between closely-related species can be extreme [5],[63] and in some cases may contribute to genetic incompatibilities between species [5],[38]. On a genome-wide level, Rsp family evolution is highly dynamic. In the time since D. sechellia, D. simulans and D. mauritiana diverged approximately 240 Kya [64] the Rsp-like satellite has dramatically changed its genomic distribution. In D. melanogaster, large blocks of the Rsp satellite occur in the pericentric heterochromatin of 2R, in D. sechellia, the Rsp-like satellite expanded and occurs in the pericentric heterochromatin of 2R, 3L and 3R, in D. simulans, the Rsp-like satellite only occurs at the base of the X chromosome and the Rsp-like satellite is undetectable at the chromosome level in D. mauritiana and D. yakuba. Rsp repeat copy number is highly polymorphic within D. melanogaster [65] this polymorphism is directly related to SD, as large blocks of satellite confer sensitivity to segregation distortion [8],[9] . The Rsp-like repeats in non-melanogaster species are presumably not targets of a meiotic drive system. It will be interesting to compare the population genetics of Rsp between species where it is and is not a target of meiotic drive.


Querying Whole Genome Shotgun (WGS), BAC assemblies, and reads

D. melanogaster reads were downloaded from the NCBI Trace Archive; BACs [27],[49] and WGS contigs [66] were downloaded from Genbank. Rsp repeats were found in the D. melanogaster WGS genome assembly (version 6.01), BACs and NCBI Trace Archive using local basic local alignment search tool (BLAST) searches. Individual traces from four BACs (AC246323.1, AC246299.1, AC007548.10, and AC009843.9; [23], Additional file 1: Figure S1) were obtained from Sue Celniker and Kenneth Wan. An iterative BLAST search protocol was used to gather all sequences matching Rsp. Initial BLAST searches were performed using Rsp sequences deposited in Genbank as queries. To capture as much variation in Rsp sequence as possible, and to recover more divergent Rsp sequences, several BLAST iterations were performed in which subsequent BLAST searches used incrementally refined lists of the hits from previous BLAST searches as queries. This iterative process ended when no additional significant hits were obtained. BLAST hits with an e-value >0.1 and a length less than 30 bp were excluded from the analysis. BLAST alignments for hits with an e-value > .001 and length <50 were inspected by eye. Redundancies between sequences were removed using custom Perl scripts. Alignments of Rsp sequences were made using BWA-SW [67]. Pairwise percent identity between Rsp repeats was calculated in Geneious (version 6.1.7, created by Biomatters;; [68] and the mean and 95% confidence intervals of pairwise percent identity were calculated in R. The same procedure was used to query the WGS assemblies of D. sechellia [28], D. simulans [69], D. erecta [28], and D. yakuba [28]. To determine that Rsp and Rsp-like repeats are indeed related sequences, the nucleotides of each repeat sequence were randomly shuffled and percent identity was re-calculated for pairwise alignments using custom perl scripts. To create a distribution of percent identity based on nucleotide composition, 10,000 permutations were completed for each sequence and P-values were obtained using the empirical cumulative distribution function for each set of permuted alignments (in R).

Querying Next Generation Sequencing (NGS) reads

Illumina GAIIX paired end reads from D. melanogaster (SRR060098; [70]), D. simulans (SRR520350; [69]), D. sechellia (SRR869587; [64]) and D. mauritiana (SRR483621; [64]) were downloaded from the NCBIs SRA ( NGS reads were trimmed of adapters and low quality bases using Trim Galore (version 0.2.8; Babraham Bioinformatics Using Bowtie2 [71], the trimmed reads were mapped to consensus Rsp sequences (from the iterative BLAST procedure described above) that capture variation within and between species from WGS and BAC sequences. The alignments were analyzed using Samtools-0.1.18 [72]. To create a list of unique Rsp sequences for each species, de novo assemblies were constructed using the mapped reads extracted from SAM files created from Bowtie2. ABySS (version 1.3.6; [73] was used for the de novo assembly with the following parameters: k =64; se; m = 30; l =64. The unique contigs were parsed for individual Rsp sequences using BLAST to the original query Rsp and custom Perl scripts (e.g. a 400-bp contig was split into three individual Rsp repeats as determined by BLAST to a consensus Rsp sequence). Some assembled repeat units were less than the canonical repeat unit length (~120 bp). Because some of these shorter units represent true fragmented repeats and some are expected to be fragments of unique repeats that the de novo technique couldn t complete (for reasons such as insufficient read depth or sequencing error), repeats with identical sequence but length variants were merged. Specifically, short, overlapping fragments with identical sequence and overhangs (non-overlapping sequence) of <50% of the total fragment length were merged into a single unique repeat. The list of unique Rsp repeats in each species was imported into Geneious (version 6.1.7 [68] to create and edit alignments.


Neighbor-joining trees (Saitou and Nei 1987) were constructed using bionj with the ape package in R. Blocks of adjacent indels were included in the model using the setting model = indelblock and bootstrapping was done using the boot.phylo function in the ape package (B = 100). Bayesian inference of the phylogenetic relationships between the RlX, Rsp-like and canonical Rsp repeats was performed using MrBayes [74] using a GTR nucleotide substitution model with Gamma rate variation. The Rsp-like sequences of the simulans clade species were consensus sequences (GenBank accession numbers: KP016744, KP016745, KP016746) of the de novo contigs assembled from each species NGS reads. The Rsp-like repeats of D. yakuba and D. erecta are consensus sequences from the BLAST of WGS assemblies. The RlX-1, RlX-2 and RlX-3 are orthologs of three tandemly-repeated RlX sequences from cytological band 4C in the region ~1 kb upstream of CG12688.

Maximum likelihood inference of the best tree for the unique Rsp sequences from the NGS reads of D. melanogaster, D. sechellia, D. simulans and D. mauritiana was performed in RAxML v7.4.2 [75] using the CIPRES Gateway (; [76]. Bootstrapping was performed using a GTR plus Gamma nucleotide substitution model (−m GTRGAMMA ? 1000). The maximum likelihood tree was drawn using the ape package in R [77]. The full tree including bootstrap confidence at the nodes is deposited in the Dryad Digital Repository (; [23]).

Fluorescence in situ hybridization (FISH)

FISH to mitotic chromosomes in larval neuroblasts was performed as previously described [78],[79]. Briefly, brains were dissected from 3rd instar larvae and fixed in 1.8% paraformaldehyde, 45% acetic acid. Fixed brains were denatured at 95 C and hybridized overnight at 30 C. Slides were washed in 4X SSCT three times, and 0.1X SSC three times before mounting in Vectashield with DAPI. The probe was a biotinylated, nick translated PCR product specific to Rsp repeats D. melanogaster (F-5 GGAAAATCACCCATTTTGATCGC and R-5 CCGAATTCAAGTACCAGAC for D. melanogaster FISH) or Rsp-like repeats in D. sechellia (F-5 ACTGATTATCATCGCCTGGT and R-5 TCCAGTTCGCCTGGTAGTTT; for D. sechellia, D. simulans, and D. mauritiana FISH).

Availability of supporting data

The data sets supporting the results of this article are available in the Dryad repository, [doi:10.5061/dryad.3sh6d and] and GenBank (KP016744-KP016746).

Additional file



Whole genome shotgun


Next generation sequencing






Responder-like on X


Segregation distorter


Bacterial artificial chromosome


Fluorescence in situ hybridization



I d like to thank Daven Presgraves for helpful discussions throughout the course of this work, anonymous reviewers and Mohamed Noor with Axios Review for helpful comments, D. Emerson Khost for pointing out Rsp-like repeat unit length, and Anthony Geneva for help with RaxML and ape. This work was supported by an NIH-NRSA fellowship (5F32GM105317-02) from the National Institute of General Medical Sciences to A.M.L. and a David and Lucile Packard Foundation grant to Daven C. Presgraves.

Authors’ Affiliations

Department of Biology, River campus, University of Rochester, Rochester, USA


  1. Orgel LE, Crick FH: Selfish DNA: the ultimate parasite. Nature. 1980, 284 (5757): 604-607. 10.1038/284604a0.PubMedView ArticleGoogle Scholar
  2. Doolittle WF, Sapienza C: Selfish genes, the phenotype paradigm and genome evolution. Nature. 1980, 284 (5757): 601-603. 10.1038/284601a0.PubMedView ArticleGoogle Scholar
  3. Ohno S: So much junk DNA in our genome. Brookhaven Symp Biol. 1972, 23: 366-370.PubMedGoogle Scholar
  4. Szybalski W: Use of cesium sulfate for equilibrium density gradient centrifugation. Methods Enzymol. 1968, 12B: 330-360. 10.1016/0076-6879(67)12149-6.View ArticleGoogle Scholar
  5. Yunis JJ, Yasmineh WG: Heterochromatin, satellite DNA, and cell function. Structural DNA of eucaryotes may support and protect genes and aid in speciation. Science. 1971, 174 (4015): 1200-1209. 10.1126/science.174.4015.1200.PubMedView ArticleGoogle Scholar
  6. Sandler L, Novitski E: Meiotic drive as an evolutionary force. Am Nat. 1957, 91 (857): 105-110. 10.1086/281969.View ArticleGoogle Scholar
  7. Sandler L, Hiraizumi Y, Sandler I: Meiotic drive in natural populations of Drosophila melanogaster. I. the cytogenetic basis of segregation-distortion. Genetics. 1959, 44 (2): 233-250.PubMedPubMed CentralGoogle Scholar
  8. Pimpinelli S, Dimitri P: Cytogenetic analysis of segregation distortion in Drosophila melanogaster: the cytological organization of the Responder (Rsp) locus. Genetics. 1989, 121 (4): 765-772.PubMedPubMed CentralGoogle Scholar
  9. Wu CI, Lyttle TW, Wu ML, Lin GF: Association between a satellite DNA sequence and the Responder of Segregation Distorter in D. melanogaster. Cell. 1988, 54 (2): 179-189. 10.1016/0092-8674(88)90550-8.PubMedView ArticleGoogle Scholar
  10. Larracuente AM, Presgraves DC: The selfish Segregation Distorter gene complex of Drosophila melanogaster . Genetics. 2012, 192 (1): 33-53. 10.1534/genetics.112.141390.PubMedPubMed CentralView ArticleGoogle Scholar
  11. Houtchens K, Lyttle TW: Responder (Rsp) alleles in the Segregation Distorter (SD) system of meiotic drive in Drosophila may represent a complex family of satellite repeat sequences. Genetica. 2003, 117 (2 3): 291-302. 10.1023/A:1022968801355.PubMedView ArticleGoogle Scholar
  12. Moschetti R, Caizzi R, Pimpinelli S: Segregation distortion in Drosophila melanogaster: genomic organization of Responder sequences. Genetics. 1996, 144 (4): 1365-1371.PubMedGoogle Scholar
  13. McAllister BF, Werren JH: Evolution of tandemly repeated sequences: What happens at the end of an array?. J Mol Evol. 1999, 48 (4): 469-481. 10.1007/PL00006491.PubMedView ArticleGoogle Scholar
  14. Kuhn GC, Kuttler H, Moreira-Filho O, Heslop-Harrison JS: The 1.688 repetitive DNA of Drosophila: concerted evolution at different genomic scales and association with genes. Mol Biol Evol. 2012, 29 (1): 7-11. 10.1093/molbev/msr173.PubMedView ArticleGoogle Scholar
  15. Eickbush TH, Eickbush DG: Finely orchestrated movements: evolution of the ribosomal RNA genes. Genetics. 2007, 175 (2): 477-485. 10.1534/genetics.107.071399.PubMedPubMed CentralView ArticleGoogle Scholar
  16. Smith GP: Evolution of repeated DNA sequences by unequal crossover. Science. 1976, 191 (4227): 528-535. 10.1126/science.1251186.PubMedView ArticleGoogle Scholar
  17. Dover G: A Molecular drive through evolution. Bioscience. 1982, 32 (6): 526-533. 10.2307/1308904.View ArticleGoogle Scholar
  18. Dover G: Concerted evolution, molecular drive and natural selection. Curr Biol. 1994, 4 (12): 1165-1166. 10.1016/S0960-9822(00)00265-7.PubMedView ArticleGoogle Scholar
  19. Elder JF, Turner BJ: Concerted evolution of repetitive DNA sequences in eukaryotes. Q Rev Biol. 1995, 70 (3): 297-320. 10.1086/419073.PubMedView ArticleGoogle Scholar
  20. Liao D: Concerted evolution: molecular mechanism and biological implications. Am J Hum Genet. 1999, 64 (1): 24-30. 10.1086/302221.PubMedPubMed CentralView ArticleGoogle Scholar
  21. Hoskins RA, Smith CD, Carlson JW, Carvalho AB, Halpern A, Kaminker JS, Kennedy C, Mungall CJ, Sullivan BA, Sutton GG, Yasuhara JC, Wakimoto BT, Myers EW, Celniker SE, Rubin GM, Karpen GH: Heterochromatic sequences in a Drosophila whole-genome shotgun assembly. Genome Biol. 2002, 3 (12): RESEARCH0085-10.1186/gb-2002-3-12-research0085.PubMedPubMed CentralView ArticleGoogle Scholar
  22. Caizzi R, Caggese C, Pimpinelli S: Bari-1, a new transposon-like family in Drosophila melanogaster with a unique heterochromatic organization. Genetics. 1993, 133 (2): 335-345.PubMedPubMed CentralGoogle Scholar
  23. Larracuente AM: Data from: the organization and evolution of the Responder satellite in species of the Drosophila melanogaster group: dynamic evolution of a target of meiotic drive. Dryad Digital Repository. doi:10.5061/dryad.3sh6d.,Google Scholar
  24. Cabot EL, Doshi P, Wu ML, Wu CI: Population genetics of tandem repeats in centromeric heterochromatin: unequal crossing over and chromosomal divergence at the Responder locus of Drosophila melanogaster . Genetics. 1993, 135 (2): 477-487.PubMedPubMed CentralGoogle Scholar
  25. Temin RG, Ganetzky B, Powers PA, Lyttle TW, Pimpinelli S, Wu C-I, Hiraizumi Y: Segregation Distorter (SD) in Drosophila melanogaster: genetic and molecular analysis. Am Nat. 1991, 137: 287-331. 10.1086/285164.View ArticleGoogle Scholar
  26. Osoegawa K, Vessere GM, Li Shu C, Hoskins RA, Abad JP, de Pablos B, Villasante A, de Jong PJ: BAC clones generated from sheared DNA. Genomics. 2007, 89 (2): 291-299. 10.1016/j.ygeno.2006.10.002.PubMedPubMed CentralView ArticleGoogle Scholar
  27. Hoskins RA, Carlson JW, Kennedy C, Acevedo D, Evans-Holm M, Frise E, Wan KH, Park S, Mendez-Lago M, Rossi F, Villasante A, Dimitri P, Karpen GH, Celniker SE: Sequence finishing and mapping of Drosophila melanogaster heterochromatin. Science. 2007, 316 (5831): 1625-1628. 10.1126/science.1139816.PubMedPubMed CentralView ArticleGoogle Scholar
  28. Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artieri CG, Barbash DA, Barker D, Barsanti P, Batterham P, Batzoglou S, Begun D, et al: Evolution of genes and genomes on the Drosophila phylogeny. Nature. 2007, 450 (7167): 203-218. 10.1038/nature06341.PubMedView ArticleGoogle Scholar
  29. Britten RJ, Kohne DE: Repeated sequences in DNA. Hundreds of thousands of copies of DNA sequences have been incorporated into the genomes of higher organisms. Science. 1968, 161 (3841): 529-540. 10.1126/science.161.3841.529.PubMedView ArticleGoogle Scholar
  30. Hatch FT, Mazrimas JA: Fractionation and characterization of satellite DNAs of Kangaroo Rat (Dipodomys-Ordii) . Nucleic Acids Res. 1974, 1 (4): 559-575. 10.1093/nar/1.4.559.PubMedPubMed CentralView ArticleGoogle Scholar
  31. Ugarkovic D, Petitpierre E, Juan C, Plohl M: Satellite DNAs in Tenebrionid species - structure, organization and evolution. Croat Chem Acta. 1995, 68 (3): 627-638.Google Scholar
  32. Zhu Q, Pao GM, Huynh AM, Suh H, Tonnu N, Nederlof PM, Gage FH, Verma IM: BRCA1 tumour suppression occurs via heterochromatin-mediated silencing. Nature. 2011, 477 (7363): 179-184. 10.1038/nature10371.PubMedPubMed CentralView ArticleGoogle Scholar
  33. Zhang P: A trans-activator on the Drosophila Y chromosome regulates gene expression in the male germ line. Genetica. 2000, 109: 141-150. 10.1023/A:1026504721067.PubMedView ArticleGoogle Scholar
  34. Pezer Z, Brajkovic J, Feliciello I, Ugarkovic D: Transcription of satellite DNAs in insects. Prog Mol Subcell Biol. 2011, 51: 161-178. 10.1007/978-3-642-16502-3_8.PubMedView ArticleGoogle Scholar
  35. Lemos B, Araripe LO, Hartl DL: Polymorphic Y chromosomes harbor cryptic variation with manifold functional consequences. Science. 2008, 319 (5859): 91-93. 10.1126/science.1148861.PubMedView ArticleGoogle Scholar
  36. Hughes SE, Gilliland WD, Cotitta JL, Takeo S, Collins KA, Hawley RS: Heterochromatic threads connect oscillating chromosomes during prometaphase I in Drosophila oocytes. PLoS Genet. 2009, 5 (1): e1000348-10.1371/journal.pgen.1000348.PubMedPubMed CentralView ArticleGoogle Scholar
  37. He B, Caudy A, Parsons L, Rosebrock A, Pane A, Raj S, Wieschaus E: Mapping the pericentric heterochromatin by comparative genomic hybridization analysis and chromosome deletions in Drosophila melanogaster . Genome Res. 2012, 22 (12): 2507-2519. 10.1101/gr.137406.112.PubMedPubMed CentralView ArticleGoogle Scholar
  38. Ferree PM, Barbash DA: Species-specific heterochromatin prevents mitotic chromosome segregation to cause hybrid lethality in Drosophila . PLoS Biol. 2009, 7 (10): e1000234-10.1371/journal.pbio.1000234.PubMedPubMed CentralView ArticleGoogle Scholar
  39. Dernburg AF, Sedat JW, Hawley RS: Direct evidence of a role for heterochromatin in meiotic chromosome segregation. Cell. 1996, 86 (1): 135-146. 10.1016/S0092-8674(00)80084-7.PubMedView ArticleGoogle Scholar
  40. Csink AK, Henikoff S: Something from nothing: the evolution and utility of satellite repeats. Trends Genet. 1998, 14 (5): 200-204. 10.1016/S0168-9525(98)01444-9.PubMedView ArticleGoogle Scholar
  41. Chippindale AK, Rice WR: Y chromosome polymorphism is a strong determinant of male fitness in Drosophila melanogaster . Proc Natl Acad Sci U S A. 2001, 98 (10): 5677-5682. 10.1073/pnas.101456898.PubMedPubMed CentralView ArticleGoogle Scholar
  42. Cattani MV, Presgraves DC: Incompatibility between X chromosome factor and pericentric heterochromatic region causes lethality in hybrids between Drosophila melanogaster and its sibling species. Genetics. 2012, 191 (2): 549-559. 10.1534/genetics.112.139683.PubMedPubMed CentralView ArticleGoogle Scholar
  43. Brennecke J, Aravin AA, Stark A, Dus M, Kellis M, Sachidanandam R, Hannon GJ: Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila . Cell. 2007, 128 (6): 1089-1103. 10.1016/j.cell.2007.01.043.PubMedView ArticleGoogle Scholar
  44. Bayes JJ, Malik HS: Altered heterochromatin binding by a hybrid sterility protein in Drosophila sibling species. Science. 2009, 326 (5959): 1538-1541. 10.1126/science.1181756.PubMedPubMed CentralView ArticleGoogle Scholar
  45. Pezer Z, Ugarkovic D: RNA Pol II promotes transcription of centromeric satellite DNA in beetles. PLoS ONE. 2008, 3 (2): e1594-10.1371/journal.pone.0001594.PubMedPubMed CentralView ArticleGoogle Scholar
  46. Sun X, Wahlstrom J, Karpen G: Molecular structure of a functional Drosophila centromere. Cell. 1997, 91 (7): 1007-1019. 10.1016/S0092-8674(00)80491-2.PubMedPubMed CentralView ArticleGoogle Scholar
  47. Henikoff S, Ahmad K, Malik HS: The centromere paradox: stable inheritance with rapidly evolving DNA. Science. 2001, 293 (5532): 1098-1102. 10.1126/science.1062939.PubMedView ArticleGoogle Scholar
  48. Walker PM: Origin of satellite DNA. Nature. 1971, 229 (5283): 306-308. 10.1038/229306a0.PubMedView ArticleGoogle Scholar
  49. Hoskins RA, Nelson CR, Berman BP, Laverty TR, George RA, Ciesiolka L, Naeemuddin M, Arenson AD, Durbin J, David RG, Tabor PE, Bailey MR, DeShazo DR, Catanese J, Mammoser A, Osoegawa K, de Jong PJ, Celniker SE, Gibbs RA, Rubin GM, Scherer SE: A BAC-based physical map of the major autosomes of Drosophila melanogaster . Science. 2000, 287 (5461): 2271-2274. 10.1126/science.287.5461.2271.PubMedView ArticleGoogle Scholar
  50. Gemayel R, Vinces MD, Legendre M, Verstrepen KJ: Variable tandem repeats accelerate evolution of coding and regulatory sequences. Annu Rev Genet. 2010, 44: 445-477. 10.1146/annurev-genet-072610-155046.PubMedView ArticleGoogle Scholar
  51. Hiraizumi Y, Nakazima K: Deviant sex ratio associated with segregation distortion in Drosophila melanogaster . Genetics. 1967, 55 (4): 681-697.PubMedPubMed CentralGoogle Scholar
  52. Kataoka Y: A genetic system modifying segregation distortion in a natural population of Drosophila melanogaster in Japan. Jap J Genet. 1967, 42: 327-337. 10.1266/jjg.42.327.View ArticleGoogle Scholar
  53. Hiraizumi Y, Thomas AM: Suppressor systems of Segregation Distorter (SD) Chromosomes in Natural Populations of Drosophila melanogaster. Genetics. 1984, 106 (2): 279-292.PubMedPubMed CentralGoogle Scholar
  54. Hiraizumi Y, Albracht JM, Albracht BC: X-linked elements associated with negative segregation distortion in the SD system of Drosophila melanogaster . Genetics. 1994, 138 (1): 145-152.PubMedPubMed CentralGoogle Scholar
  55. Gell SL, Reenan RA: Mutations to the piRNA pathway component aubergine enhance meiotic drive of segregation distorter in Drosophila melanogaster . Genetics. 2013, 193 (3): 771-784. 10.1534/genetics.112.147561.PubMedPubMed CentralView ArticleGoogle Scholar
  56. Tao Y, Araripe L, Kingan SB, Ke Y, Xiao H, Hartl DL: A sex-ratio meiotic drive system in Drosophila simulans. II: an X-linked distorter. PLoS Biol. 2007, 5 (11): e293-10.1371/journal.pbio.0050293.PubMedPubMed CentralView ArticleGoogle Scholar
  57. Pezer Z, Ugarkovic D: Transcription of pericentromeric heterochromatin in beetles satellite DNAs as active regulatory elements. Cytogenet Genome Res. 2009, 124 (3 4): 268-276. 10.1159/000218131.PubMedView ArticleGoogle Scholar
  58. Carone DM, Longo MS, Ferreri GC, Hall L, Harris M, Shook N, Bulazel KV, Carone BR, Obergfell C, O'Neill MJ, O'Neill RJ: A new class of retroviral and satellite encoded small RNAs emanates from mammalian centromeres. Chromosoma. 2009, 118 (1): 113-125. 10.1007/s00412-008-0181-5.PubMedView ArticleGoogle Scholar
  59. Saito K, Nishida KM, Mori T, Kawamura Y, Miyoshi K, Nagami T, Siomi H, Siomi MC: Specific association of Piwi with rasiRNAs derived from retrotransposon and heterochromatic regions in the Drosophila genome. Gene Dev. 2006, 20 (16): 2214-2222. 10.1101/gad.1454806.PubMedPubMed CentralView ArticleGoogle Scholar
  60. Powers PA, Ganetzky B: On the components of segregation distortion in Drosophila melanogaster. V Molecular analysis of the Sd locus. Genetics. 1991, 129 (1): 133-144.PubMedPubMed CentralGoogle Scholar
  61. Presgraves DC, Gerard PR, Cherukuri A, Lyttle TW: Large-scale selective sweep among Segregation Distorter chromosomes in African populations of Drosophila melanogaster . PLoS Genet. 2009, 5 (5): e1000463-10.1371/journal.pgen.1000463.PubMedPubMed CentralView ArticleGoogle Scholar
  62. Levinson G, Gutman GA: Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Mol Biol Evol. 1987, 4 (3): 203-221.PubMedGoogle Scholar
  63. Ugarkovic D, Plohl M: Variation in satellite DNA profiles causes and effects. EMBO J. 2002, 21 (22): 5955-5959. 10.1093/emboj/cdf612.PubMedView ArticleGoogle Scholar
  64. Garrigan D, Kingan SB, Geneva AJ, Andolfatto P, Clark AG, Thornton KR, Presgraves DC: Genome sequencing reveals complex speciation in the Drosophila simulans clade. Genome Res. 2012, 22 (8): 1499-1511. 10.1101/gr.130922.111.PubMedPubMed CentralView ArticleGoogle Scholar
  65. Temin RG, Marthas M: Factors influencing the effect of segregation distortion in natural populations of Drosophila melanogaster . Genetics. 1984, 107 (3): 375-393.PubMedPubMed CentralGoogle Scholar
  66. Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, Amanatides PG, Scherer SE, Li PW, Hoskins RA, Galle RF, George RA, Lewis SE, Richards S, Ashburner M, Henderson SN, Sutton GG, Wortman JR, Yandell MD, Zhang Q, Chen LX, Brandon RC, Rogers YH, Blazej RG, Champe M, Pfeiffer BD, Wan KH, Doyle C, Baxter EG, Helt G, Nelson CR, et al: The genome sequence of Drosophila melanogaster . Science. 2000, 287 (5461): 2185-2195. 10.1126/science.287.5461.2185.PubMedView ArticleGoogle Scholar
  67. Li H, Durbin R: Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics. 2010, 26 (5): 589-595. 10.1093/bioinformatics/btp698.PubMedPubMed CentralView ArticleGoogle Scholar
  68. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A: Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012, 28 (12): 1647-1649. 10.1093/bioinformatics/bts199.PubMedPubMed CentralView ArticleGoogle Scholar
  69. Hu TT, Eisen MB, Thornton KR, Andolfatto P: A second-generation assembly of the Drosophila simulans genome provides new insights into patterns of lineage-specific divergence. Genome Res. 2013, 23 (1): 89-98. 10.1101/gr.141689.112.PubMedPubMed CentralView ArticleGoogle Scholar
  70. Mackay TF, Richards S, Stone EA, Barbadilla A, Ayroles JF, Zhu D, Casillas S, Han Y, Magwire MM, Cridland JM, Richardson MF, Anholt RR, Barron M, Bess C, Blankenburg KP, Carbone MA, Castellano D, Chaboub L, Duncan L, Harris Z, Javaid M, Jayaseelan JC, Jhangiani SN, Jordan KW, Lara F, Lawrence F, Lee SL, Librado P, Linheiro RS, Lyman RF, et al: The Drosophila melanogaster Genetic Reference Panel. Nature. 2012, 482 (7384): 173-178. 10.1038/nature10811.PubMedPubMed CentralView ArticleGoogle Scholar
  71. Langmead B, Salzberg SL: Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012, 9 (4): 357-359. 10.1038/nmeth.1923.PubMedPubMed CentralView ArticleGoogle Scholar
  72. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R: The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009, 25 (16): 2078-2079. 10.1093/bioinformatics/btp352.PubMedPubMed CentralView ArticleGoogle Scholar
  73. Simpson JT, Wong K, Jackman SD, Schein JE, Jones SJ, Birol I: ABySS: a parallel assembler for short read sequence data. Genome Res. 2009, 19 (6): 1117-1123. 10.1101/gr.089532.108.PubMedPubMed CentralView ArticleGoogle Scholar
  74. Huelsenbeck JP, Ronquist F: MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics. 2001, 17 (8): 754-755. 10.1093/bioinformatics/17.8.754.PubMedView ArticleGoogle Scholar
  75. Stamatakis A: RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics. 2006, 22 (21): 2688-2690. 10.1093/bioinformatics/btl446.PubMedView ArticleGoogle Scholar
  76. Miller MA, Pfeiffer W, Schwartz T: Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Proceedings of the Gateway Computing Environments Workshop (GCE): November 14, 2010. 2010, IEEE, New Orleans, LA, 1-8. 10.1109/GCE.2010.5676129.View ArticleGoogle Scholar
  77. Paradis E, Claude J, Strimmer K: APE: analyses of phylogenetics and evolution in R language. Bioinformatics. 2004, 20 (2): 289-290. 10.1093/bioinformatics/btg412.PubMedView ArticleGoogle Scholar
  78. Larracuente AM, Noor MA, Clark AG: Translocation of Y-linked genes to the dot chromosome in Drosophila pseudoobscura . Mol Biol Evol. 2010, 27 (7): 1612-1620. 10.1093/molbev/msq045.PubMedPubMed CentralView ArticleGoogle Scholar
  79. Larracuente AM, Ferree PM: Simple method for fluorescence DNA in situ hybridization to 2-D chromosomes. JoVE. in press.,Google Scholar


© Larracuente; licensee BioMed Central. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.
