Skip to main content

Advertisement

Table 2 Clonostachys rosea S8A serine protease genes and oligonucleotides used for RT-qPCR gene expression analysis

From: Comparative evolutionary histories of fungal proteases reveal gene gains in the mycoparasitic and nematode-parasitic fungus Clonostachys rosea

Protein ID Gene name Forward Primer (5′ → 3′) Reverse Primer (5′ → 3′)
BN8691_T00011169 prs1 CGCGGCAAGCATGGTGAAGAAG CAACAGCCGCGCCATAGTTTGAAT
BN8691_T00008996 prs2 GGCCTTGCTCGCATCTCCAGT GGCCGTTTCCGTCAGTATTGTCAC
BN8691_T00010953 prs3 GGCGGCCGAGCGTCTATGGTA AAGGGCGGTGTTTCTGCTGACG
BN8691_T00008718 prs4 CTGCCATGGCCGGAGTCGTAG CTTTGGGGCAGCTTCGTGTGGT
BN8691_T00008991 prs5 GCCCCCAGAGCACGTATTTGAGAG CGCCGGGCTGAGTGGTGAAG
BN8691_T00008504 prs6 TTTCTACCCTCCCCAACAACGCTACT ATCACTGGGGATACCGGTCAAGATA
BN8691_T00008401 prs7 GAACGCCCTTCGCAACCATCC GTTCCCTCACCGGCACTACTGTCAT
BN8691_T00008478 prs8 GGCATTGACTCGCTCGCTCCAG AACAGTGCCGGCAGGTATATTCTTGAC
BN8691_T00010709 prs9 CGGCAGCCCTCCCATCAAAC CGGGGCAAACACGTCAACTCC
BN8691_T00002560 prs10 CCTCGGTGGTTTCTCTGCCTCTC CCGCCGCCTTCCTTGTATGTG
BN8691_T00006503 prs11 ATGATCGCCGGAATGGAGAAGGT CATCAATGGGGGTGCCGAAGATA
BN8691_T00012020 prs12 CGCCGCTGGGCTTTGTGAGT CATTTAAGCCGCTTCGCCATTTT
BN8691_T00010529 prs13 CGTCGCTGCTGGCAATGGAGA CGCCGGGGCCGAAAATGTC
BN8691_T00004335 prs14 CCTCGACTCCGGTGGCTCTGGTA CCGCTGGGGACGCTGGTGAT
BN8691_T00009031 prs15 AAGGTCGGCGGCGGCTCTAC CGCTGGGGACCTTCTTGATGACA
BN8691_T00009071 prs16 GTTTCGCCGCCAGCCTTACC GTAGTGCCACCGGGAGACTGAGAA
BN8691_T00000462 prs17 ATGGGGGATTTCACGCCTTTCTTC TTCGGGATGGGCAATAGCAATACC
BN8691_T00007432 prs18 CCGCCGCCATTGCTGACTC TTGACACCGGGGGCGAAGAT