Skip to main content

Advertisement

Table 1 Chromosomal location, length and primers used for each of the 4 genes studied

From: Patterns of geographic variation of thermal adapted candidate genes in Drosophila subobscura sex chromosome arrangements

Genea Alignmentb Primers (Forward; Reverse) 5’UTR Exons Introns
PhKgamma (CG1830, GA14880) 831 bp (895 bp) 5′ - CATGACCTGGCGCAGTATTG - 3′ 5′ - TAACAGCGGAGCGAGCAGTC - 3’ 1–240 241–332 333–895
Ubc-E2H (CG2257, GA15327) 1085 bp (1100 bp) 5’ - TCACTGTAGTCGGACATGCT - 3′ 5′ - AGGAGAGCAACGTCACAGAT - 3’ 1–662 663–1100
Hfw (CG3095, GA15922) 1073 bp (1079 bp) 5’ - GCATTCAAGCGGTCCGTTAA - 3′ 5′ - TATGTTGAGGCACTTGAGCG - 3’   349–1079 1–348
Nipsnap (CG9212, GA21617) 1095 bp (1168 bp) 5’ - CATGCGACTGTGAGCCTCTT - 3′ 5′ -CGCAGCAATACAACAAGTGG - 3’ 1–411 412–470; 1149–1168 471–1148
  1. aGene symbol of the homologous gene in D. melanogaster and D. pseudoobscura respectively in parentheses
  2. balignment length with D.pseudoobcura in parentheses. 5’ UTR, introns and exon positions are referred relative to the D. pseudoobscura alignment