Skip to main content

Advertisement

Table 4 Adapters and Primers used in C genome specific sequence preparation

From: Polyploid evolution in Oryza officinalis complex of the genus Oryza

sequence name primer name Sequence(5'-3')
CS-1 CS1-F TTTCCCAATCAAGTTCCT
  CS1-R ACGGTGGTAATGGTAGCC
CS-2 CS2-F AAACAGCAGCGGAAAGAG
  CS2-R GCAAATAGCCATAAGCC
CS-3 CS3-F CAAACCCAAACCACCCAAGC
  CS3-R GAACCATACCATCGCCGTCA
CS-4 CS4-F CTGGTGCCTGCTTTAGTC
  CS4-R CCATACCGTTGCCTCTTA
CS-5 CS5-F ACGACCAAGCCGACCAAC
  CS5-R TGCCTCTTCCACCACTAACT
CS-6 CS6-F GCTTTGGGTTGGACTTGAC
  CS6-R TGAACTCGGTGAGATTGGA
CS-7 CS7-F GGCTGACTGAAGGGAGGAGG
  CS7-R TGAGGTTGGACGCTGGACTG
CS-8 CS8-F ATCATTCATTGCTCCATTC
  CS8-R AACAGCGTCCTCACCAG
adapter-C C-adp1 GACCTCGTGTCTGCGTACC
  C-adp2 TAGGTACGCAGACACGAG
adapter-B B-adp1* GACGATGAGTCCTGAG
  B-adp2 TACTCAGGACTCAT
  1. * 5' end biotinylated