Skip to main content

Advertisement

Table 2 Specific primers designed from SNPs in the dimeric α-amylase inhibitor genes

From: Molecular evolution of dimeric α-amylase inhibitor genes in wild emmer wheat and its ecological association

Primer Sequences* Fragment size Temperature Cycle
W19G ATGCTCGTGGCGACACT CG 426 64 32
W24A TCGTGGCGACACCCRTAC CA 422 63 35
W35A ACCCATAGCAGCCCAGTACAA 412 62 35
W46A CGAGTACGACGCATGGAT CA 400 65 35
W47AT AGTACGACGCATGGAGT AT 398 57 35
W125G CTGTCGTCCATTGCTT AG 319 62.5 35
W127G CTGTCGTCCATTGCTGAGGG 319 62.5 35
W190C CTGCTGCCAGCAGCTCGG CC 256 57 35
W195T TGCCAGCAGCTCGCCGACATT 252 51 35
W207T ACATCAGCGAGTGGA GT 236 60.5 30
W259A CATGTATAAGGAGCATGT CA 187 61 35
W263C TATAAGGAGCATGGCGTC TC 183 62 30
W263A TATAAGGAGCATGGCGTC TA 183 65 35
W276A GCGTGTCGGAGGGACAGT CA 170 60 35
W288CG GACAGGCRGGGACAGGA A CG 158 66 30
W288AG GACAGGCGGGGACAGGA A AG 158 63.5 30
  1. *SNP positions were on the 3' end of the primers and are identified in bold letters. Extra mismatched nucleotides were also incorporated in the primers (underlined).