Skip to main content

Table 2 Primers used for amplification and sequencing

From: Dugesia sicula (Platyhelminthes, Tricladida): the colonizing success of an asexual Planarian

Name Sequence 5′-3′ An. Temp. (°C)1 Source
BarT (F)* ATGACDGCSCATGGTTTAATAATGAT 43 Álvarez-Presas et al., [27]
COIbarc_plat_R (R) TAATTAAAATATAAACCTCAGGATG 40 Lázaro et al.[8]
  1. F forward, R reverse, *Only for amplification, **Only for sequencing 1 Annealing Temperature.