Skip to main content

Table 2 Characteristics of eight microsatellite loci for Myotis davidii.

From: Pleistocene glacial cycle effects on the phylogeography of the Chinese endemic bat species, Myotis davidii

Locus Primer[μM] MgCl2[μM] Primer sequence (5'-3') Fragment size (bp) HW P value Fluorescein tag
A13 0.45 2 F: AACGTTCATTCTGCCAAAGG 409-421 0.849 FAM
E24 0.25 1.5 F: GCAGGTTCAATCCCTGACC 220-228 0.841 FAM
H29 0.35 1.5 F: TCAGGTGAGGATTGAAAACAC 164-188 0.95 FAM
G9 0.25 1.5 F: AGGGGACATACAAGAATCAACC 162-178 0.9912 FAM
D9 0.25 2 F: TCTTTCCTCCCCTGTGCTC 104-136 0.812 HEX
G25 0.25 1.5 F: TCCTTCCCATTTCTGTGAGG 131-137 0.861 HEX
G30 0.25 1.5 F: TTGCCAAATTCTGGTATCTTCC 130-156 0.6029 HEX
C113 0.25 1.5 F: ACCTCCCTGCCCTGCAC 98-102 0.74 HEX